4.6

CiteScore

2.2

Impact Factor
  • ISSN 1674-8301
  • CN 32-1810/R
Volume 37 Issue 4
Jul.  2023
Turn off MathJax
Article Contents
Abstract
Introduction
Materials and methods
Results
Discussion
Acknowledgments
Acknowledgments
References
Related Articles
Natalia V. Naryzhnaya, Leonid N. Maslov, Ivan A. Derkachev, Huijie Ma, Yi Zhang, N. Rajendra Prasad, Nirmal Singh, Feng Fu, Jianming Pei, Akpay Sarybaev, Akylbek Sydykov. The effect of an adaptation to hypoxia on cardiac tolerance to ischemia/reperfusion[J]. The Journal of Biomedical Research, 2023, 37(4): 230-254. DOI: 10.7555/JBR.36.20220125
Citation: Natalia V. Naryzhnaya, Leonid N. Maslov, Ivan A. Derkachev, Huijie Ma, Yi Zhang, N. Rajendra Prasad, Nirmal Singh, Feng Fu, Jianming Pei, Akpay Sarybaev, Akylbek Sydykov. The effect of an adaptation to hypoxia on cardiac tolerance to ischemia/reperfusion[J]. The Journal of Biomedical Research, 2023, 37(4): 230-254. DOI: 10.7555/JBR.36.20220125
shu

The effect of an adaptation to hypoxia on cardiac tolerance to ischemia/reperfusion

  • 1.

    Laboratory of Experimental Cardiology, Cardiology Research Institute, Tomsk National Research Medical Center, Russian Academy of Science, Tomsk, Tomsk Region 634012, Russia

  • 2.

    Department of Physiology, Hebei Medical University, Shijiazhuang, Hebei 050017, China

  • 3.

    Department of Biochemistry and Biotechnology, Faculty of Science, Annamalai University, Annamalainagar, Tamilnadu 608002, India

  • 4.

    Department of Pharmaceutical Sciences and Drug Research, Punjabi University, Patiala, Punjabi 147002, India

  • 5.

    Department of Physiology and Pathophysiology, National Key Discipline of Cell Biology, School of Basic Medicine, the Fourth Military Medical University, Xi'an, Shaanxi 710032, China

  • 6.

    Department of Mountain and Sleep Medicine and Pulmonary Hypertension, National Center of Cardiology and Internal Medicine, Bishkek 720040, Kyrgyzstan

  • 7.

    Kyrgyz-Indian Mountain Biomedical Research Center, Bishkek 720033, Kyrgyzstan

  • 8.

    Department of Internal Medicine, Excellence Cluster Cardio-Pulmonary Institute (CPI), Member of the German Center for Lung Research (DZL), Justus Liebig University of Giessen, Giessen, Hessen 35392, Germany

  • 9.

    Department of Mountain and Sleep Medicine and Pulmonary Hypertension, National Center of Cardiology and Internal Medicine, Bishkek 720040, Kyrgyzstan

Funds: This work was supported by the Russian Science Foundation grant 22-15-00048. The section dedicated to the role of kinases in the cardioprotective effect of chronic hypoxia is framed within the framework of state assignments 122020300042-4.
More Information
  • Corresponding author:

    Leonid N. Maslov, Laboratory of Experimental Cardiology, Cardiology Research Institute, Tomsk National Research Medical Center of the RAS, Kievskaya 111A, Tomsk, Tomsk Region 634012, Russia. Tel: +7-3822-262174, E-mail: maslov@cardio-tomsk.ru

  • Received Date: May 25, 2022
  • Revised Date: August 30, 2022
  • Accepted Date: September 04, 2022
  • Available Online: October 27, 2022
    Graphical Abstract
    • Abstract
  • The acute myocardial infarction (AMI) and sudden cardiac death (SCD), both associated with acute cardiac ischemia, are one of the leading causes of adult death in economically developed countries. The development of new approaches for the treatment and prevention of AMI and SCD remains the highest priority for medicine. A study on the cardiovascular effects of chronic hypoxia (CH) may contribute to the development of these methods. Chronic hypoxia exerts both positive and adverse effects. The positive effects are the infarct-reducing, vasoprotective, and antiarrhythmic effects, which can lead to the improvement of cardiac contractility in reperfusion. The adverse effects are pulmonary hypertension and right ventricular hypertrophy. This review presents a comprehensive overview of how CH enhances cardiac tolerance to ischemia/reperfusion. It is an in-depth analysis of the published data on the underlying mechanisms, which can lead to future development of the cardioprotective effect of CH. A better understanding of the CH-activated protective signaling pathways may contribute to new therapeutic approaches in an increase of cardiac tolerance to ischemia/reperfusion.
    • FullText(HTML)

  • Flap transplantation is commonly used to repair tissue defect and reconstruct organs. The transplanted flaps (random, axial, or free) may undergo ischemia and reperfusion, a complex pathophysiological process of injury. Experimental studies have shown that oxygen free radical damage and calcium overload can cause vascular endothelial apoptosis, inflammatory response and other lesions, all contribute to ischemia-reperfusion injury[1–3].

    Vascular endothelial cells participate in various physiological activities, such as synthesizing biological substances, contracting blood vessels, maneuvering blood flow, activating blood coagulation and regulating platelet aggregation[4–7]. In skin flaps, ischemia-reperfusion (I/R) can inflict endothelial cells with morphological and functional abnormalities, such as apoptosis, inflammatory substance synthesis[8–9].

    As a key mediator in immune and inflammatory responses, IL-1 undergoes its signaling pathway through the activation of interleukin-1 receptor (IL-1R)[10–11] followed by nuclear factor-κB (NF-κB) signaling pathway, a crucial link between immune and inflammatory systems[12], whose function depends on myeloid differentiation primary-response protein 88 (MyD88)[13]. The IL-1R signaling pathway is engaged in skin flap ischemia-reperfusion injury. TIR/BB-loop mimetic (AS-1) has a structural similarity to the TIR/BB domain of MyD88, and can inhibit the downstream signal transduction caused by IL-1[14]. Our previous study has found AS-1 can relieve myocardial ischemia-reperfusion injury by inhibiting MyD88-dependent signaling pathway[15]. But whether AS-1 can decrease H/R-induced injury in vascular endothelial cells remains to be elucidated.

    Here, by using paraffin sections made of skin flaps from patients along with HE and TUNEL staining, we found inflammation may play a critical role in endothelial cell I/R injury, and we examined the role of AS-1 in repressing endothelial cell injury induced by H/R. Furthermore, AS-1 improved VECs viability and attenuated macrophage migration, presumably by inhibiting the interaction between IL-1R and MyD88, and following phosphorylation of IκB and p38 pathway, as well as the nuclear localization of NF-KB subunit p65/p50.

    Cell culture and reagents

    Human umbilical vein endothelial cells H926 (ATCC, USA) were maintained in HG-DMEM medium (Life Technologies, USA) supplemented with 10% fetal bovine serum in a humidified atmosphere containing 5% CO2 at 37 °C.

    Cell treatment

    AS-1 was dissolved in DMSO, and stored at −20 °C. For the cell viability test, H926 cells were stimulated with 0, 25, 50, and 100 μmol/L of AS-1 for 72 hours. To evaluate the protective effect of AS-1, H926 cells were pretreated with 50 μmol/L of AS-1 or DMSO for 30 minutes. H/R group cells were placed in a humidified atmosphere containing 1% O 2 and 5% CO2 for 4 hours, and then 20% O2 and 5% CO2 for required time.

    Tissue paraffin section and staining

    The normal, necrotic, and border areas of the skin flap were fixed with 4% formalin. HE (Beyotime, China) and TUNEL (Roche, Germany) staining were performed according to the manufacturer's instructions. The skin flap tissue was obtained from Taixing People's Hospital, and the study was approved by Ethical Committee of Taixing People's Hospital.

    Western blotting assay

    Cytoplasmic proteins were prepared from harvested cells. Western blotting was performed as described previously[9]. Briefly, the cytoplasmic proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto PVDF membranes (Cell Signaling Technology, USA). The membranes were incubated with the appropriate primary antibodies followed by incubation with peroxidase-conjugated secondary antibodies. The signals were detected using the ECL system. The same membranes were probed with antibodies for GAPDH (1:5000, Sigma, USA). The signals were quantified by scanning densitometry. Computer-assisted image analysis was performed using Image J. The primary antibodies included anti-cleaved caspase-3, anti-Bax, anti-Bcl-2, anti-phospho-p38, anti-phospho-IκB, anti-Tublin, and anti-LaminB (all diluted in 1:1000, Cell Signaling Technology).

    Flow cytometric analysis

    The assay was performed according to the manufacturer's instruction. Briefly, both treated and untreated cells were harvested, washed with PBS, suspended in Annexin V binding buffer (10 mmol/L HEPES, pH 7.4; 2.5 mmol/L CaCl2, 140 mmol/L NaCl), stained with Annexin V-FITC (BD Biosciences, USA), and evaluated by the FACScalibur flow cytometer.

    Cell viability assay by CCK8

    H926 cells were seeded in a 96-well plate (5 000 cells/well), pre-incubated for 24 hours in a humidified incubator (37 °C, 5% CO2), and treated as above. Then after 10 μL of CCK-8 solution was added into each well, the plate was incubated for 4 hours. The absorbance was measured using a microplate reader at 450 nm.

    Scratch wound closure assay

    H926 cells were seeded in six-well plates and allowed to proliferate to a density of 80% (the cells nearly attaching to each other). Then the cell monolayer was scratched using a 1 mL pipette tip. Each well was washed once with growth media to remove cell debris. To record scratch wound closure, the images were captured at 0, 12, 24, and 48 hours until the wound was closed.

    Transwell assay

    RAW264.7 cell solution was plated on top of the filter membrane in a transwell insert and incubated at 37 °C and 5% CO2. H926 cells were plated on the bottom of the lower chamber in a 24-well plate and treated as described above. The transwell insert was added without generating bubbles, incubated for 24 hours, and then removed from the plate. A cotton-tipped applicator was used to carefully remove the media. The cells that had not migrated from the membrane top were retained. Then, 70% ethanol was added into a 24-well plate to fix the cells. After removing the transwell insert, the remaining ethanol was removed from the top of the membrane using a cotton-tipped applicator. The membrane was positioned into a 24-well plate with 0.2% crystal violet and incubated at room temperature for 5–10 minutes for staining. The crystal violet was gently removed from the membrane top with a pipette tip. The cells on the membrane were photographed with SLR camera.

    Total RNA extraction and qRT-PCR

    Total RNA was extracted from cells using RNAiso reagent (Takara Biotechnology, Japan) and RT-PCR assays were performed with the Prime-ScriptTM RT detection kit (Takara Biotechnology) as previously described. Amplification and detection of specific products were performed using the ABI Prism 7500 sequence detection system with the cycles indicated by the Prime-ScriptTMRT detection kit. As an internal control, HPRT primers were used for RNA template normalization. qRT-PCR primers were presented in Table 1 . Relative levels of the target gene mRNA expression were calculated and expressed as 2−△△Ct.

    Table  1.  PCR primer sequences
    Name Sequences (5′-3′)
    IL-1α-F CCAGAAGAAAATGAGGTCGG
    IL-1α-R AGCGCTCAAGGAGAAGACC
    MCP-1-F CCCACTCACCTGCTGCTACT
    MCP-1-R TTCCTTCTTGGG GTC AGC AC
    TNFα-F AGGGTCTGGGCCATAGAACT
    TNFα-R CCACCACGCTCTTCTGTCTAC
    HRPT-F GTTGGATACAGGCCAGACTTTGTT
    HPRT-R GATTCAACTTGCGCTCATCTTAGGC
     | Show Table
    DownLoad: CSV

    Co-immunoprecipitation

    Cytoplasmic proteins were incubated with anti-IL-1R antibody (Santa Cruz Biotechnology, USA) for 2 hours at 4 °C on a rotator. Then, 20 μL protein A/G beads (Santa Cruz Biotechnology) was added to each sample followed by incubation overnight at 4 °C on a rotator. The samples were centrifuged briefly in a microcentrifuge and washed three times in the 1 mL lysis wash buffer (250 mmol/L NaCl, 1% NP-40, 1 mmol/L PMSF, 5 mg/mL aprotinin, and 5 mg/mL leupeptin) (pH 8.0). Loading buffer (pH 6.8) was added to each sample and boiled for 5 minutes.

    Statistical analysis

    All results were expressed as mean±standard deviation (SD). One-way ANOVA was used to test the differences between the groups. Comparisons between two groups were performed using Student's t-test. A P-value <0.05 was considered statistically significant.

    Ischemia-reperfusion of skin flap underwent pathological changes

    Skin flap samples were obtained from patients who suffered from burns and received flap transplantation. The normal, necrotic, and border samples were taken in situ. The border samples showed marked edema and inflammatory cell infiltration; the necrotic samples presented more inflammatory cells with disappeared organizational structure (Fig. 1A ). TUNEL staining indicated a larger number of apoptotic cells in necrotic tissues than in the normal tissues (Fig. 1B ).

    Figure  1.  Different flap morphology after flap transplantation.
    A: HE staining, more inflammatory cell infiltration in the perivascular and subcutaneous tissues at the edge of the necrotic flap; the disordered subcutaneous tissue of the necrotic flap, a large number of infiltrated inflammatory cells, significantly reduced vascular structure. B: TUNEL staining, obvious cell apoptosis, including vascular endothelial cell apoptosis, in the subcutaneous tissue of the necrotic flaps. Scale bar, 100 µm.
    DownLoad: Full-Size Img PowerPoint

    AS-1 ameliorated the viability of vascular endothelial cell injured by H/R

    To verify the effect of AS-1 in flap ischemia-reperfusion injury, we employed vascular endothelial cells in vitro. Firstly, we tested the cytotoxicity AS-1 exerted to vascular endothelial cells. The vascular endothelial cells were stimulated by AS-1 at different concentrations for 72 hours. Cell viability was detected by the CCK8 kit. There was no significant toxicity in endothelial cells was detected with different concentrations of AS-1 (Supplementary Fig. 1 , available online). Further, the viability of vascular endothelial cells was significantly inhibited by H/R compared with the control group. However, AS-1 could significantly ameliorate the H/R-impaired cellular viability, while the solvent control group showed no difference (Fig. 2A and B ).

    DownLoad: Full-Size Img PowerPoint

    AS-1 attenuated H/R-induced vascular endothelial cell apoptosis

    FACS analysis indicated H/R stimulation significantly promoted the apoptosis of vascular endothelial cells compared with the control group. In contrast, AS-1 could significantly prevent cell apoptosis compared to the solvent control (Fig. 3A ). H/R stimulation significantly increased the expression of apoptotic protein Bax, decreased the expression of anti-apoptotic protein Bcl-2, while AS-1 prevented these H/R-induced changes (Fig. 3B ). Also, AS-1 decreased the activation of caspase-3 as indicated by cleaved-caspase-3 (Fig. 3C ).

    Figure  3.  AS-1 attenuated H/R-induced vascular endothelial cell apoptosis.
    A: Vascular endothelial cells were treated as described. Flow cytometry was used to detect apoptosis. B and C: Western blotting was performed to detect molecular involved in cell apoptosis. n=3, *P<0.05 vs. Control; #P<0.05 vs. H/R+DMSO.
    DownLoad: Full-Size Img PowerPoint

    AS-1 promoted the repair in H/R-damaged vascular endothelial cells

    H/R stimulation significantly inhibited the repair of endothelial cells, as evidenced by their prolonged time spent in repairing. AS-1 pretreatment significantly promoted the repair of vascular endothelial cells, but this change was not observed in the solvent control group (Fig. 4 ).

    Figure  4.  AS-1 ameliorated cell migration which was impaired by H/R.
    H926 cells were seeded in 96-well plates and pretreated with AS-1 and control solvent for half an hour before being subjected to hypoxia for 4 hours. The scratch wound closure assay was performed, images were captured at 0, 12, 24, and 48 hours.
    DownLoad: Full-Size Img PowerPoint

    AS-1 inhibited H/R-activated and IL-1R mediated signaling pathway

    The interaction between IL-1R and MyD88 through TIR/BB domain is essential to signaling transduction. Co-IP indicated H/R treatment enhanced the interaction between IL-1R and MyD88, while AS-1 repressed this process (Fig. 5A ). Compared with the control group, H/R obviously induced the phosphorylation of p38 and IκB protein. However, after AS-1 pretreatment, the expression of p-p38 protein was significantly inhibited by H/R, which was found in the solvent control group (Fig. 5B and C ). Immunofluorescence indicated that p50 subunit assembled in the nucleus. WB indicated that p65 subunit mainly appeared in the nuclear under H/R, but AS-1 reversed the above effect (Fig. 5D and E ).

    Figure  5.  AS-1 inhibited the activation of IL-1R mediated signaling pathway.
    A: Co-immunoprecipitation was taken using anti-IL-1R antibody to analyze the interaction between IL-1R and MyD88. B and C: Cells total lysate was collected to perform Western blotting assays. D: Immunofluorescence and confocal microscopy were employed to detect the p50 nuclear localization. E: Subcellular fractionation was collected to detect p65 location, GAPDH was taken as the cell plasma protein marker and Laminin B was taken as the nuclear protein marker. Scale bar, 100 µm.
    DownLoad: Full-Size Img PowerPoint

    AS-1 ameliorated macrophage migration induced by conditioned medium from H/R-treated cells

    H/R treatment significantly promoted the synthesis of inflammatory cytokines (IL-1, TNF-α, MCP-1, IL-6 and IL-8) in vascular endothelial cells compared with the control group, however, the pretreatment of AS-1 before hypoxia significantly inhibited the expression of inflammatory cytokines, which was not found in the solvent control (Fig. 6A–E ). Further, the conditioned medium from H/R treatment group significantly promoted the migration of macrophages. By contrast, no similar effect was detected in the conditioned medium derived from the AS-1 pretreated group (Fig. 6F ).

    Figure  6.  AS-1 repressed the inflammatory cytokine synthesis induced by H/R, and repressed the migration of macrophages induced by conditional medium from H/R treated cells.
    A–E: Total mRNA was extracted and qRT-PCR was performed to detect expression levels of IL-1, TNF-α, MCP-1, IL-6, and IL-8. F: RAW264.7 macrophages were seeded in transwell chambers. After H/R stimulation, the transwell chambers were inserted into a 12-well plate and crystal violet staining was performed 24 hours later. n=3, *P<0.05 vs. Control; #P<0.05 vs. H/R+DMSO.
    DownLoad: Full-Size Img PowerPoint

    In the present study, cell apoptosis and inflammatory response were found in ischemia-reperfusion-injured skin flap tissue. In this study, we used AS-1 to ameliorate H/R-induced endothelial cell injury. Indeed, in the case of hypoxia and reoxygenation, the viability of the vascular endothelial cells was significantly decreased, cell apoptosis significantly increased, and the cell migration significantly slowed down; AS-1 efficiently protected the cells through attenuating the phosphorylation of p38 and IκB. H/R stimulation significantly induced synthesis of inflammatory cytokines IL-1, TNF-α and chemokine MCP-1 in vascular endothelial cells, but this induction was inhibited by AS-1. AS-1 also ameliorated macrophage migration induced by conditioned medium from H/R treated vascular endothelial cells.

    As mentioned before, ischemia reperfusion is a powerful risk factor for skin flap injury[1–3], so finding the exact mechanism and new treating strategy is urgently needed. The ischemia-reperfusion flap injury features abnormal morphology and function of endothelial cells[8–9]. We found vascular endothelial cell damage was significantly aggravated after H/R treatment in vitro, mainly due to the decreased cell viability and increased apoptosis, which is similar to the findings of previous studies[16].

    During ischemia-reperfusion injury, MAPKs[17–18] and NF-κB[19] are activated in damaged vascular endothelial cells. MAPKs are intracellular serine/threonine protein kinases, including ERK, JNK, and p38MAPK. Recent studies have shown that ERK, JNK, and p38MAPK are closely related to acute inflammation and skin cancer[20]. In ischemia-reperfusion flaps, the MAPKs are also activated[21]. Ischemia-reperfusion can also activate NF-κB signaling pathway. NF-κB, an important nuclear transcription factor, is indispensable for immune inflammation. Studies have shown that ischemia-reperfusion can induce the production of cytokines, such as IL-1β, TNF-α in endothelial and inflammatory cells. Notably, the expression of inflammatory mediators and factors (such as IL-1, IL-6 and TNF-α) exacerbates the inflammatory response, while the inhibition of NF-κB expression prevents the release of inflammatory factors[22–23]. It is suggested that the activation of inflammatory signaling pathway participates in ischemia-reperfusion-induced injury of vascular endothelial cells.

    AS-1 is a lipids-soluble substance that easily enters the cell and mimics the sequence of a tripeptide [(F/Y)-(V/L/I)-(P/G)] in the MyD88-TIR-BB loop. AS-1 can bind to MyD88-TIR region competing with IL-1R-TIR domain and inhibit IL-1β-increased phosphorylation of IRAK-1 and p38-MAPK in vitro. In this study, we found that AS-1 could significantly inhibit the phosphorylation of p38 and IκB. In conclusion, TIR/BB-loop analog AS-1 can protect vascular endothelial cells from H/R injury through inhibiting the expression of inflammatory cytokines induced by H/R. This mechanism involves the activation of MAPKs and NF-κB ensuing IL-1R down-regulation. The present study provides a theoretical basis for clinical prevention and treatment of flap ischemia-reperfusion injury.

    This work was supported by the National Natural Science Foundation of China (No. 81470418 and No. 81770230).

    None.

    CLC number: R542.2, Document code: A

    The authors reported no conflict of interests.

    • References (243)
  • [1]
    Musil J, Procházka J, Krofta K, et al. Effect of chronic systemic hypoxia of the methaemoglobin type on the rat myocardium and its resistance to anoxia[J]. Physiol Bohemoslov, 1966, 15(4): 357–361. https://pubmed.ncbi.nlm.nih.gov/4224277/
    [2]
    Poupa O, Krofta K, Prochazka J, et al. The resistance of the myocardium to anoxia in animals acclimated to simulated altitude[J]. Physiol Bohemoslov, 1965, 14: 233–237. https://pubmed.ncbi.nlm.nih.gov/14330883/
    [3]
    Poupa O, Krofta K, Rakusan K, et al. Myoglobin content of the heart and resistance of the isolated myocardium to anoxia in vitro during adaptation to high altitude hypoxia[J]. Physiol Bohemoslov, 1966, 15(5): 450–453. https://pubmed.ncbi.nlm.nih.gov/4230152/
    [4]
    Poupa O, Krofta K, Prochazka J, et al. Acclimation to simulated high altitude and acute cardiac necrosis[J]. Fed Proc, 1966, 25(4): 1243–1246. https://pubmed.ncbi.nlm.nih.gov/5913895/
    [5]
    Meerson FZ, Gomzakov OA, Shimkovich MV. Adaptation to high altitude hypoxia as a factor preventing development of myocardial ischemic necrosis[J]. Am J Cardiol, 1973, 31(1): 30–34. doi: 10.1016/0002-9149(73)90806-0
    [6]
    Meerson FZ, Ustinova EE, Orlova EH. Prevention and elimination of heart arrhythmias by adaptation to intermittent high altitude hypoxia[J]. Clin Cardiol, 1987, 10(12): 783–789. doi: 10.1002/clc.4960101202
    [7]
    Kronenberg RS, Safar P, Lee J, et al. Pulmonary artery pressure and alveolar gas exchange in man during acclimatization to 12, 470 ft[J]. J Clin Invest, 1971, 50(4): 827–837. doi: 10.1172/JCI106554
    [8]
    Pen̄aloza D, Sime F. Chronic cor pulmonale due to loss of altitude acclimatization (chronic mountain sickness)[J]. Am J Med, 1971, 50(6): 728–743. doi: 10.1016/0002-9343(71)90181-1
    [9]
    Sime F, Peñaloza D, Ruiz L. Bradycardia, increased cardiac output, and reversal of pulmonary hypertension in altitude natives living at sea level[J]. Br Heart J, 1971, 33(5): 647–657. doi: 10.1136/hrt.33.5.647
    [10]
    Yellon DM, Downey JM. Preconditioning the myocardium: from cellular physiology to clinical cardiology[J]. Physiol Rev, 2003, 83(4): 1113–1151. doi: 10.1152/physrev.00009.2003
    [11]
    Heusch G. Myocardial ischaemia-reperfusion injury and cardioprotection in perspective[J]. Nat Rev Cardiol, 2020, 17(12): 773–789. doi: 10.1038/s41569-020-0403-y
    [12]
    Neckář J, Ošťádal B, Kolář F. Myocardial infarct size-limiting effect of chronic hypoxia persists for five weeks of normoxic recovery[J]. Physiol Res, 2004, 53(6): 621–628. https://pubmed.ncbi.nlm.nih.gov/15588130/
    [13]
    Zhang Y, Zhong N, Zhu H, et al. Antiarrhythmic and antioxidative effects of intermittent hypoxia exposure on rat myocardium[J]. Acta Physiol Sin, 2000, 52(2): 89–92. https://pubmed.ncbi.nlm.nih.gov/11961574/
    [14]
    Meerson FZ, Boev VM, Kots II, et al. The effect of adaptation to periodic hypoxia on the tolerance of untrained subjects for physical loading and idiopathic cardiac arrhythmias[J]. Fiziol Cheloveka (in Russian), 1990, 16(1): 94–105. https://pubmed.ncbi.nlm.nih.gov/2358161/
    [15]
    Aleshin IA, Tin’kov AN, Kots II, et al. Experience in treating patients with cardiovascular diseases by means of adaptation to periodic barochamber hypoxia[J]. Ter Arkh (in Russian), 1997, 69(1): 54–58. https://pubmed.ncbi.nlm.nih.gov/9163053/
    [16]
    Uskina EV, Maslov LN, Lishmanov YB. Antiarrhythmic effect of hypoxic preconditioning is mediated by activation of μ- and δ-opioid receptors[J]. Bull Exp Biol Med, 1998, 125(3): 239–241. doi: 10.1007/BF02496869
    [17]
    Li J, Xu J, Xiao J, et al. Preservation of TSPO by chronic intermittent hypobaric hypoxia confers antiarrhythmic activity[J]. J Cell Mol Med, 2011, 15(1): 134–140. doi: 10.1111/j.1582-4934.2009.00949.x
    [18]
    Zhou J, Ma H, Liu Y, et al. The anti-arrhythmic effect of chronic intermittent hypobaric hypoxia in rats with metabolic syndrome induced with fructose[J]. Can J Physiol Pharmacol, 2015, 93(4): 227–232. doi: 10.1139/cjpp-2014-0343
    [19]
    Estrada JA, Williams AG Jr, Sun J, et al. δ-Opioid receptor (DOR) signaling and reactive oxygen species (ROS) mediate intermittent hypoxia induced protection of canine myocardium[J]. Basic Res Cardiol, 2016, 111(2): 17. doi: 10.1007/s00395-016-0538-5
    [20]
    Barbé C, Rochetaing A, Kreher P. Ischemic tolerance of the heart by adaptation to chronic hypoxia is suppressed by high subchronic carbon monoxide exposure[J]. Inhal Toxicol, 2001, 13(3): 219–232. doi: 10.1080/08958370150502458
    [21]
    Morand J, Arnaud C, Pepin JL, et al. Chronic intermittent hypoxia promotes myocardial ischemia-related ventricular arrhythmias and sudden cardiac death[J]. Sci Rep, 2018, 8(1): 2997. doi: 10.1038/s41598-018-21064-y
    [22]
    Manukhina EB, Belkina LM, Terekhina OL, et al. Normobaric, intermittent hypoxia conditioning is cardio- and vasoprotective in rats[J]. Exp Biol Med, 2013, 238(12): 1413–1420. doi: 10.1177/1535370213508718
    [23]
    Mallet RT, Ryou MG, Williams AG, et al. β1-Adrenergic receptor antagonism abrogates cardioprotective effects of intermittent hypoxia[J]. Basic Res Cardiol, 2006, 101(5): 436–446. doi: 10.1007/s00395-006-0599-y
    [24]
    Naryzhnaya NV, Mukhamedzyanov AV, Lasukova TV, et al. Involvement of autonomic nervous system in antiarrhythmic effect of intermittent hypobaric hypoxia[J]. Bull Exp Biol Med, 2017, 163(3): 299–301. doi: 10.1007/s10517-017-3789-8
    [25]
    Kohutova J, Elsnicova B, Holzerova K, et al. Anti-arrhythmic cardiac phenotype elicited by chronic intermittent hypoxia is associated with alterations in connexin-43 expression, phosphorylation, and distribution[J]. Front Endocrinol, 2019, 9: 789. doi: 10.3389/fendo.2018.00789
    [26]
    Asemu G, Neckár J, Szárszoi O, et al. Effects of adaptation to intermittent high altitude hypoxia on ischemic ventricular arrhythmias in rats[J]. Physiol Res, 2000, 49(5): 597–606. https://pubmed.ncbi.nlm.nih.gov/11191364/
    [27]
    Neckár J, Borchert GH, Hlousková P, et al. Brief daily episode of normoxia inhibits cardioprotection conferred by chronic continuous hypoxia. Role of oxidative stress and BKCa channels[J]. Curr Pharm Des, 2013, 19(39): 6880–6889. doi: 10.2174/138161281939131127115154
    [28]
    Lishmanov IB, Naryzhnaia NV, Maslov LN, et al. The opiatergic link between the antiarrhythmic effect of adaptation and hypoxia in the model of ischemia and reperfusion in vivo[J]. Patol Fiziol Eksp Ter (in Russian), 2003, (1): 19–21. https://pubmed.ncbi.nlm.nih.gov/12652938/
    [29]
    Wolfe BB, Voelkel NF. Effects of hypoxia on atrial muscarinic cholinergic receptors and cardiac parasympathetic responsiveness[J]. Biochem Pharmacol, 1983, 32(13): 1999–2002. doi: 10.1016/0006-2952(83)90418-5
    [30]
    De Ferrari GM, Vanoli E, Curcuruto P, et al. Prevention of life-threatening arrhythmias by pharmacologic stimulation of the muscarinic receptors with oxotremorine[J]. Am Heart J, 1992, 124(4): 883–890. doi: 10.1016/0002-8703(92)90968-2
    [31]
    Bober SL, Ciriello J, Jones DL. Atrial arrhythmias and autonomic dysfunction in rats exposed to chronic intermittent hypoxia[J]. Am J Physiol Heart Circ Physiol, 2018, 314(6): H1160–H1168. doi: 10.1152/ajpheart.00173.2017
    [32]
    Wu W, Lu Z. Loss of anti-arrhythmic effect of vagal nerve stimulation on ischemia-induced ventricular tachyarrhythmia in aged rats[J]. Tohoku J Exp Med, 2011, 223(1): 27–33. doi: 10.1620/tjem.223.27
    [33]
    Vanoli E, De Ferrari GM, Stramba-Badiale M, et al. Vagal stimulation and prevention of sudden death in conscious dogs with a healed myocardial infarction[J]. Circ Res, 1991, 68(5): 1471–1481. doi: 10.1161/01.RES.68.5.1471
    [34]
    Wang S, Han H, Jiang Y, et al. Activation of cardiac M3 muscarinic acetylcholine receptors has cardioprotective effects against ischaemia-induced arrhythmias[J]. Clin Exp Pharmacol Physiol, 2012, 39(4): 343–349. doi: 10.1111/j.1440-1681.2012.05672.x
    [35]
    Lin M, Liu R, Gozal D, et al. Chronic intermittent hypoxia impairs baroreflex control of heart rate but enhances heart rate responses to vagal efferent stimulation in anesthetized mice[J]. Am J Physiol Heart Circ Physiol, 2007, 293(2): H997–H1006. doi: 10.1152/ajpheart.01124.2006
    [36]
    Stembridge M, Ainslie PN, Hughes MG, et al. Ventricular structure, function, and mechanics at high altitude: chronic remodeling in Sherpa vs. short-term lowlander adaptation[J]. J Appl Physiol, 2014, 117(3): 334–343. doi: 10.1152/japplphysiol.00233.2014
    [37]
    Herrera EA, Farías JG, González-Candia A, et al. Ω3 Supplementation and intermittent hypobaric hypoxia induce cardioprotection enhancing antioxidant mechanisms in adult rats[J]. Mar Drugs, 2015, 13(2): 838–860. doi: 10.3390/md13020838
    [38]
    Wu S, Li Y, Shi Z, et al. Alteration of cholinergic anti-inflammatory pathway in rat with ischemic cardiomyopathy-modified electrophysiological function of heart[J]. J Am Heart Assoc, 2017, 6(9): e006510. doi: 10.1161/JAHA.117.006510
    [39]
    Zhang Y, Zhong N, Zhou Z. Effects of intermittent hypoxia on action potential and contraction in non-ischemic and ischemic rat papillary muscle[J]. Life Sci, 2000, 67(20): 2465–2471. doi: 10.1016/S0024-3205(00)00832-8
    [40]
    Naryzhnaia NV, Neckar J, Maslov LN, et al. The role of sarcolemmal and mitochondrial K(ATP)-channels in realization of the cardioprotection and antiarrhythmic effect of different regimens of hypobaric adaptation[J]. Ross Fiziol Zh Im I M Sechenova (in Russian), 2009, 95(8): 837–849. https://pubmed.ncbi.nlm.nih.gov/19803213/
    [41]
    Neckář J, Papoušek F, Nováková O, et al. Cardioprotective effects of chronic hypoxia and ischaemic preconditioning are not additive[J]. Basic Res Cardiol, 2002, 97(2): 161–167. doi: 10.1007/s003950200007
    [42]
    Tsibulnikov SY, Maslov LN, Naryzhnaya NV, et al. Role of protein kinase C, PI3 kinase, tyrosine kinases, NO-synthase, KATP channels and MPT pore in the signaling pathway of the cardioprotective effect of chronic continuous hypoxia[J]. Gen Physiol Biophys, 2018, 37(5): 537–547. doi: 10.4149/gpb_2018013
    [43]
    Neckář J, Sźárszoi O, Herget J, et al. Cardioprotective effect of chronic hypoxia is blunted by concomitant hypercapnia[J]. Physiol Res, 2003, 52(2): 171–175. https://pubmed.ncbi.nlm.nih.gov/12678659/
    [44]
    Neckář J, Marková I, Novák F, et al. Increased expression and altered subcellular distribution of PKC-δin chronically hypoxic rat myocardium: involvement in cardioprotection[J]. Am J Physiol Heart Circ Physiol, 2005, 288(4): H1566–H1572. doi: 10.1152/ajpheart.00586.2004
    [45]
    Kolář F, Neckář J, Ošťádal B. MCC-134, a blocker of mitochondrial and opener of sarcolemmal ATP-sensitive K+ channels, abrogates cardioprotective effects of chronic hypoxia[J]. Physiol Res, 2005, 54(4): 467–471. https://pubmed.ncbi.nlm.nih.gov/16117602/
    [46]
    Meng X, Yu H, Zhang W, et al. ZFP580, a novel zinc-finger transcription factor, is involved in cardioprotection of intermittent high-altitude hypoxia against myocardial ischemia-reperfusion injury[J]. PLoS One, 2014, 9(4): e94635. doi: 10.1371/journal.pone.0094635
    [47]
    Xu W, Yu Z, Xie Y, et al. Therapeutic effect of intermittent hypobaric hypoxia on myocardial infarction in rats[J]. Basic Res Cardiol, 2011, 106(3): 329–342. doi: 10.1007/s00395-011-0159-y
    [48]
    Bourdier G, Flore P, Sanchez H, et al. High-intensity training reduces intermittent hypoxia-induced ER stress and myocardial infarct size[J]. Am J Physiol Heart Circ Physiol, 2016, 310(2): H279–H289. doi: 10.1152/ajpheart.00448.2015
    [49]
    Milano G, Abruzzo PM, Bolotta A, et al. Impact of the phosphatidylinositide 3-kinase signaling pathway on the cardioprotection induced by intermittent hypoxia[J]. PLoS One, 2013, 8(10): e76659. doi: 10.1371/journal.pone.0076659
    [50]
    Maslov LN, Naryzhnaia NV, Tsibulnikov SY, et al. Role of endogenous opioid peptides in the infarct size-limiting effect of adaptation to chronic continuous hypoxia[J]. Life Sci, 2013, 93(9–11): 373–379. doi: 10.1016/j.lfs.2013.07.018
    [51]
    Moulin S, Arnaud C, Bouyon S, et al. Curcumin prevents chronic intermittent hypoxia-induced myocardial injury[J]. Ther Adv Chronic Dis, 2020, 11: 2040622320922104. doi: 10.1177/2040622320922104
    [52]
    Wang Z, Si L. Hypoxia-inducible factor-1α and vascular endothelial growth factor in the cardioprotective effects of intermittent hypoxia in rats[J]. Ups J Med Sci, 2013, 118(2): 65–74. doi: 10.3109/03009734.2013.766914
    [53]
    Kasparova D, Neckar J, Dabrowska L, et al. Cardioprotective and nonprotective regimens of chronic hypoxia diversely affect the myocardial antioxidant systems[J]. Physiol Genomics, 2015, 47(12): 612–620. doi: 10.1152/physiolgenomics.00058.2015
    [54]
    Kolář F, Ježková J, Balková P, et al. Role of oxidative stress in PKC-δupregulation and cardioprotection induced by chronic intermittent hypoxia[J]. Am J Physiol Heart Circ Physiol, 2007, 292(1): H224–H230. doi: 10.1152/ajpheart.00689.2006
    [55]
    Hrdlička J, Neckář J, Papoušek F, et al. Beneficial effect of continuous normobaric hypoxia on ventricular dilatation in rats with post-infarction heart failure[J]. Physiol Res, 2016, 65(5): 867–870. doi: 10.33549/physiolres.933308
    [56]
    Zhu W, Xie Y, Chen L, et al. Intermittent high altitude hypoxia inhibits opening of mitochondrial permeability transition pores against reperfusion injury[J]. J Mol Cell Cardiol, 2006, 40(1): 96–106. doi: 10.1016/j.yjmcc.2005.09.016
    [57]
    Ma H, Li Q, Ma H, et al. Chronic intermittent hypobaric hypoxia ameliorates ischemia/reperfusion-induced calcium overload in heart via Na+/Ca2+ exchanger in developing rats[J]. Cell Physiol Biochem, 2014, 34(2): 313–324. doi: 10.1159/000363001
    [58]
    Maslov LN, Naryzhnaya NV, Prokudina ES, et al. Preserved cardiac mitochondrial function and reduced ischaemia/reperfusion injury afforded by chronic continuous hypoxia: role of opioid receptors[J]. Clin Exp Pharmacol Physiol, 2015, 42(5): 496–501. doi: 10.1111/1440-1681.12383
    [59]
    Prokudina ES, Naryzhnaya NV, Mukhomedzyanov AV, et al. Effect of chronic continuous normobaric hypoxia on functional state of cardiac mitochondria and tolerance of isolated rat heart to ischemia and reperfusion: role of µ and δ2 opioid receptors[J]. Physiol Res, 2019, 68(6): 909–920. doi: 10.33549/physiolres.933945
    [60]
    Naryzhnaya NV, Prokudina ES, Nesterov EA, et al. The role of cardiac opioid receptors in the cardioprotective effect of continuous normobaric hypoxia[J]. Bull Exp Biol Med, 2020, 168(6): 727–729. doi: 10.1007/s10517-020-04789-7
    [61]
    Naryzhnaya NV, Khaliulin I, Lishmanov YB, et al. Participation of opioid receptors in the cytoprotective effect of chronic normobaric hypoxia[J]. Physiol Res, 2019, 68(2): 245–253. https://www.biomed.cas.cz/physiolres/pdf/2019/68_245.pdf
    [62]
    Borchert GH, Yang C, Kolář F. Mitochondrial BKCa channels contribute to protection of cardiomyocytes isolated from chronically hypoxic rats[J]. Am J Physiol Heart Circ Physiol, 2011, 300(2): H507–H513. doi: 10.1152/ajpheart.00594.2010
    [63]
    Holzerová K, Hlaváčková M, Žurmanová J, et al. Involvement of PKCε in cardioprotection induced by adaptation to chronic continuous hypoxia[J]. Physiol Res, 2015, 64(2): 191–201. https://www.biomed.cas.cz/physiolres/pdf/64/64_191.pdf
    [64]
    Xu S, Jia L, Liu X, et al. Effect of chronic intermittent hypobaric hypoxia on cardiac function in female metabolic syndrome rats[J]. Adapt Med, 2021, 13: 8–15. doi: 10.4247/AM.2021.ACB257
    [65]
    Dong J, Zhu H, Zhu W, et al. Intermittent hypoxia attenuates ischemia/reperfusion induced apoptosis in cardiac myocytes via regulating Bcl-2/Bax expression[J]. Cell Res, 2003, 13(5): 385–391. doi: 10.1038/sj.cr.7290184
    [66]
    Kolar D, Gresikova M, Waskova-Arnostova P, et al. Adaptation to chronic continuous hypoxia potentiates Akt/HK2 anti-apoptotic pathway during brief myocardial ischemia/reperfusion insult[J]. Mol Cell Biochem, 2017, 432(1–2): 99–108. doi: 10.1007/s11010-017-3001-5
    [67]
    Xie S, Deng Y, Pan Y, et al. Chronic intermittent hypoxia induces cardiac hypertrophy by impairing autophagy through the adenosine 5’-monophosphate-activated protein kinase pathway[J]. Arch Biochem Biophys, 2016, 606: 41–52. doi: 10.1016/j.abb.2016.07.006
    [68]
    Chang JC, Hu W, Lee WS, et al. Intermittent hypoxia induces autophagy to protect cardiomyocytes from endoplasmic reticulum stress and apoptosis[J]. Front Physiol, 2019, 10: 995. doi: 10.3389/fphys.2019.00995
    [69]
    Gyongyosi A, Terraneo L, Bianciardi P, et al. The impact of moderate chronic hypoxia and hyperoxia on the level of apoptotic and autophagic proteins in myocardial tissue[J]. Oxid Med Cell Longev, 2018, 2018: 5786742. doi: 10.1155/2018/5786742
    [70]
    Nedvedova I, Kolar D, Elsnicova B, et al. Mitochondrial genome modulates myocardial Akt/Glut/HK salvage pathway in spontaneously hypertensive rats adapted to chronic hypoxia[J]. Physiol Genomics, 2018, 50(7): 532–541. doi: 10.1152/physiolgenomics.00040.2017
    [71]
    Rathod KS, Koganti S, Jain AK, et al. Complete versus culprit only revascularisation in patients with cardiogenic shock complicating acute myocardial infarction: incidence and outcomes from the London heart attack group[J]. Cardiovasc Revasc Med, 2020, 21(3): 350–358. doi: 10.1016/j.carrev.2019.06.007
    [72]
    Kopylov YN, Golubeva LY. Effect of adaptation to periodic hypoxia on stability of myocardial energy metabolism and contractility parameters in the presence of acute anoxia and reoxygenation[J]. Bull Exp Biol Med, 1991, 111(1): 27–30. doi: 10.1007/BF00841231
    [73]
    Krylatov AV, Tsibulnikov SY, Mukhomedzyanov AV, et al. The role of natriuretic peptides in the regulation of cardiac tolerance to ischemia/reperfusion and postinfarction heart remodeling[J]. J Cardiovasc Pharmacol Ther, 2021, 26(2): 131–148. doi: 10.1177/1074248420952243
    [74]
    Casserly B, Pietras L, Schuyler J, et al. Cardiac atria are the primary source of ANP release in hypoxia-adapted rats[J]. Life Sci, 2010, 87(11–12): 382–389. doi: 10.1016/j.lfs.2010.07.013
    [75]
    Lordick F, Hauck RW, Senekowitsch R, et al. Atrial natriuretic peptide in acute hypoxia-exposed healthy subjects and in hypoxaemic patients[J]. Eur Respir J, 1995, 8(2): 216–221. doi: 10.1183/09031936.95.08020216
    [76]
    Winter RJD, Meleagros L, Pervez S, et al. Atrial natriuretic peptide levels in plasma and in cardiac tissues after chronic hypoxia in rats[J]. Clin Sci (Lond), 1989, 76(1): 95–101. doi: 10.1042/cs0760095
    [77]
    Bullard AJ, Govewalla P, Yellon DM. Erythropoietin protects the myocardium against reperfusion injury in vitro and in vivo[J]. Basic Res Cardiol, 2005, 100(5): 397–403. doi: 10.1007/s00395-005-0537-4
    [78]
    Piperno A, Galimberti S, Mariani R. Modulation of hepcidin production during hypoxia-induced erythropoiesis in humans in vivo: data from the HIGHCARE project[J]. Blood, 2011, 117(10): 2953–2959. doi: 10.1182/blood-2010-08-299859
    [79]
    Feizi H, Rajaee K, Keyhanmanesh R, et al. Effect of ghrelin on renal erythropoietin production in chronic hypoxic rats[J]. Endocr Regul, 2014, 48(1): 3–8. doi: 10.4149/endo_2014_01_3
    [80]
    Schmidt W, Spielvogel H, Eckardt KU, et al. Effects of chronic hypoxia and exercise on plasma erythropoietin in high-altitude residents[J]. J Appl Physiol, 1993, 74(4): 1874–1878. doi: 10.1152/jappl.1993.74.4.1874
    [81]
    Zhang S, Ma K, Liu Y, et al. Stabilization of hypoxia-inducible factor by DMOG inhibits development of chronic hypoxia-induced right ventricular remodeling[J]. J Cardiovasc Pharmacol, 2016, 67(1): 68–75. doi: 10.1097/FJC.0000000000000315
    [82]
    Asimakis GK, Inners-McBride K, Conti VR, et al. Transient β adrenergic stimulation can precondition the rat heart against postischaemic contractile dysfunction[J]. Cardiovasc Res, 1994, 28(11): 1726–1734. doi: 10.1093/cvr/28.11.1726
    [83]
    Ravingerová T, Pancza D, Ziegelhoffer A, et al. Preconditioning modulates susceptibility to ischemia-induced arrhythmias in the rat heart: the role of α-adrenergic stimulation and K(ATP) channels[J]. Physiol Res, 2002, 51(2): 109–119. https://www.biomed.cas.cz/physiolres/pdf/51/51_109.pdf
    [84]
    Shin MK, Han W, Joo H, et al. Effect of adrenal medullectomy on metabolic responses to chronic intermittent hypoxia in the frequently sampled intravenous glucose tolerance test[J]. J Appl Physiol, 2017, 122(4): 767–774. doi: 10.1152/japplphysiol.00975.2016
    [85]
    Zoccal DB, Bonagamba LGH, Oliveira FRT, et al. Increased sympathetic activity in rats submitted to chronic intermittent hypoxia[J]. Exp Physiol, 2007, 92(1): 79–85. doi: 10.1113/expphysiol.2006.035501
    [86]
    Oštádal B, Ressl J, Urbanová D, et al. The effect of beta adrenergic blockade on pulmonary hypertension, right ventricular hypertrophy and polycythaemia, induced in rats by intermittent high altitude hypoxia[J]. Basic Res Cardiol, 1978, 73(5): 422–432. doi: 10.1007/BF01906523
    [87]
    Zhu B, Simonis U, Cecchini G, et al. Comparison of pyrroloquinoline quinone and/or metoprolol on myocardial infarct size and mitochondrial damage in a rat model of ischemia/reperfusion injury[J]. J Cardiovasc Pharmacol Ther, 2006, 11(2): 119–128. doi: 10.1177/1074248406288757
    [88]
    Hu A, Jiao X, Gao E, et al. Chronic β-adrenergic receptor stimulation induces cardiac apoptosis and aggravates myocardial ischemia/reperfusion injury by provoking inducible nitric-oxide synthase-mediated nitrative stress[J]. J Pharmacol Exp Ther, 2006, 318(2): 469–475. doi: 10.1124/jpet.106.102160
    [89]
    Du X, Gao X, Kiriazis H, et al. Transgenic α1A-adrenergic activation limits post-infarct ventricular remodeling and dysfunction and improves survival[J]. Cardiovasc Res, 2006, 71(4): 735–743. doi: 10.1016/j.cardiores.2006.06.015
    [90]
    León-Velarde F, Bourin MC, Germack R, et al. Differential alterations in cardiac adrenergic signaling in chronic hypoxia or norepinephrine infusion[J]. Am J Physiol Regul Integr Comp Physiol, 2001, 280(1): R274–R281. doi: 10.1152/ajpregu.2001.280.1.R274
    [91]
    Wang P, Gallagher KP, Downey JM, et al. Pretreatment with endothelin-1 mimics ischemic preconditioning against infarction in isolated rabbit heart[J]. J Mol Cell Cardiol, 1996, 28(3): 579–588. doi: 10.1006/jmcc.1996.0054
    [92]
    Bugge E, Ytrehus K. Endothelin-1 can reduce infarct size through protein kinase C and KATP channels in the isolated rat heart[J]. Cardiovasc Res, 1996, 32(5): 920–929. doi: 10.1016/S0008-6363(96)00129-0
    [93]
    Duda M, Konior A, Klemenska E, et al. Preconditioning protects endothelium by preventing ET-1-induced activation of NADPH oxidase and xanthine oxidase in post-ischemic heart[J]. J Mol Cell Cardiol, 2007, 42(2): 400–410. doi: 10.1016/j.yjmcc.2006.10.014
    [94]
    Zhang M, Gu W, Hong X. Involvement of endothelin 1 in remote preconditioning-induced cardioprotection through connexin 43 and Akt/GSK-3β signaling pathway[J]. Sci Rep, 2018, 8(1): 10941. doi: 10.1038/s41598-018-29196-x
    [95]
    Tamareille S, Terwelp M, Amirian J, et al. Endothelin-1 release during the early phase of reperfusion is a mediator of myocardial reperfusion injury[J]. Cardiology, 2013, 125(4): 242–249. doi: 10.1159/000350655
    [96]
    Blumberg FC, Wolf K, Arzt M, et al. Effects of ET-A receptor blockade on eNOS gene expression in chronic hypoxic rat lungs[J]. J Appl Physiol, 2003, 94(2): 446–452. doi: 10.1152/japplphysiol.00239.2002
    [97]
    Pan P, Zhang X, Qian H, et al. Effects of electro-acupuncture on endothelium-derived endothelin-1 and endothelial nitric oxide synthase of rats with hypoxia-induced pulmonary hypertension[J]. Exp Biol Med, 2010, 235(5): 642–648. doi: 10.1258/ebm.2010.009353
    [98]
    Wang N, Chang Y, Chen L, et al. Tanshinone IIA protects against chronic intermittent hypoxia-induced myocardial injury via activating the endothelin 1 pathway[J]. Biomed Pharmacother, 2017, 95: 1013–1020. doi: 10.1016/j.biopha.2017.08.036
    [99]
    Hamid SA, Baxter GF. Adrenomedullin limits reperfusion injury in experimental myocardial infarction[J]. Basic Res Cardiol, 2005, 100(5): 387–396. doi: 10.1007/s00395-005-0538-3
    [100]
    Nishida H, Sato T, Miyazaki M, et al. Infarct size limitation by adrenomedullin: protein kinase A but not PI3-kinase is linked to mitochondrial KCa channels[J]. Cardiovasc Res, 2008, 77(2): 398–405. https://academic.oup.com/cardiovascres/article/77/2/398/432211
    [101]
    Gong Y, Fan X, Wu X, et al. Changes of intermedin/adrenomedullin 2 and its receptors in the right ventricle of rats with chronic hypoxic pulmonary hypertension[J]. Acta Physiol Sin, 2007, 59(2): 210–214. https://kns.cnki.net/KCMS/detail/detail.aspx?dbcode=CJFD&dbname=CJFD2007&filename=SLXU200702015
    [102]
    Wang S, Yu Z, Liu K, et al. Synthesis and release of pulmonary tissue adrenomedullin on hypoxic pulmonary hypertension in rats and its significance[J]. Chin J Tuberc Respir Dis, 2001, 24(12): 725–727. https://pubmed.ncbi.nlm.nih.gov/11930700/
    [103]
    Cheng Y, Dai L, Xia G. The alterations and clinical significance of serum thyroid hormone levels in patients with acute exacerbation of chronic obstructive pulmonary disease[J]. Chin J Tuberc Respir Dis, 2016, 39(12): 939–943. http://rs.yiigle.com/resource_static.jspx?contentId=931446
    [104]
    Tsibulnikov S, Maslov L, Voronkov N, et al. Thyroid hormones and the mechanisms of adaptation to cold[J]. Hormones, 2020, 19(3): 329–339. doi: 10.1007/s42000-020-00200-2
    [105]
    Jeddi S, Zaman J, Zadeh-Vakili A, et al. Involvement of inducible nitric oxide synthase in the loss of cardioprotection by ischemic postconditioning in hypothyroid rats[J]. Gene, 2016, 580(2): 169–176. doi: 10.1016/j.gene.2016.01.014
    [106]
    Maslov LN, Khaliulin I, Oeltgen PR, et al. Prospects for creation of cardioprotective and antiarrhythmic drugs based on opioid receptor agonists[J]. Med Res Rev, 2016, 36(5): 871–923. doi: 10.1002/med.21395
    [107]
    Naryzhnaya NV, Maslov LN, Prokudina ES, et al. Contribution of opioid receptors to the cytoprotective effect of the adaptation to chronic hypoxia at anoxia/reoxygenation of isolated cardiomyocytes[J]. Bull Exp Biol Med, 2015, 159(2): 209–212. doi: 10.1007/s10517-015-2924-7
    [108]
    Pei J, Zhou J, Bian J, et al. Impaired [Ca2+]i and pHiresponses to κ-opioid receptor stimulation in the heart of chronically hypoxic rats[J]. Am J Physiol Cell Physiol, 2000, 279(5): C1483–C1494. doi: 10.1152/ajpcell.2000.279.5.C1483
    [109]
    Yuan F, Li H, Song S, et al. Opioid receptors mediate enhancement of ACh-induced aorta relaxation by chronic intermittent hypobaric hypoxia[J]. Acta Physiol Sin, 2013, 65(3): 269–275. https://kns.cnki.net/KCMS/detail/detail.aspx?dbcode=CJFD&dbname=CJFD2013&filename=SLXU201303005
    [110]
    Wu J, Li P, Wu X, et al. Chronic intermittent hypoxia decreases pain sensitivity and increases the expression of HIF1α and opioid receptors in experimental rats[J]. Sleep Breath, 2015, 19(2): 561–568. doi: 10.1007/s11325-014-1047-0
    [111]
    Li C, Chen L, Song M, et al. Ferulic acid protects cardiomyocytes from TNF-α/cycloheximide-induced apoptosis by regulating autophagy[J]. Arch Pharm Res, 2020, 43(8): 863–874. doi: 10.1007/s12272-020-01252-z
    [112]
    Degterev A, Hitomi J, Germscheid M, et al. Identification of RIP1 kinase as a specific cellular target of necrostatins[J]. Nat Chem Biol, 2008, 4(5): 313–321. doi: 10.1038/nchembio.83
    [113]
    Gao C, Liu Y, Yu Q, et al. TNF-α antagonism ameliorates myocardial ischemia-reperfusion injury in mice by upregulating adiponectin[J]. Am J Physiol Heart Circ Physiol, 2015, 308(12): H1583–H1591. doi: 10.1152/ajpheart.00346.2014
    [114]
    Chytilová A, Borchert GH, Mandíková-Alánová P, et al. Tumour necrosis factor-α contributes to improved cardiac ischaemic tolerance in rats adapted to chronic continuous hypoxia[J]. Acta Physiol, 2015, 214(1): 97–108. doi: 10.1111/apha.12489
    [115]
    Alánová P, Chytilová A, Neckář J, et al. Myocardial ischemic tolerance in rats subjected to endurance exercise training during adaptation to chronic hypoxia[J]. J Appl Physiol, 2017, 122(6): 1452–1461. doi: 10.1152/japplphysiol.00671.2016
    [116]
    Bilenko MV. Ischemic and reperfusion injury to organs[M]. Editors: Medicine, Moscow, 1989.
    [117]
    Krylatov AV, Maslov LN, Voronkov NS, et al. Reactive oxygen species as intracellular signaling molecules in the cardiovascular system[J]. Curr Cardiol Rev, 2018, 14(4): 290–300. doi: 10.2174/1573403X14666180702152436
    [118]
    Lien CF, Lee WS, Wang IC, et al. Intermittent hypoxia-generated ROS contributes to intracellular zinc regulation that limits ischemia/reperfusion injury in adult rat cardiomyocyte[J]. J Mol Cell Cardiol, 2018, 118: 122–132. doi: 10.1016/j.yjmcc.2018.03.014
    [119]
    Chang JC, Lien CF, Lee WS, et al. Intermittent hypoxia prevents myocardial mitochondrial Ca2+ overload and cell death during ischemia/reperfusion: the role of reactive oxygen species[J]. Cells, 2019, 8(6): 564. doi: 10.3390/cells8060564
    [120]
    Mrakic-Sposta S, Gussoni M, Dellanoce C, et al. Effects of acute and sub-acute hypobaric hypoxia on oxidative stress: a field study in the Alps[J]. Eur J Appl Physiol, 2021, 121(1): 297–306. doi: 10.1007/s00421-020-04527-x
    [121]
    Mallet RT, Burtscher J, Richalet JP, et al. Impact of high altitude on cardiovascular health: current perspectives[J]. Vasc Health Risk Manag, 2021, 17: 317–335. doi: 10.2147/VHRM.S294121
    [122]
    Balková P, Hlaváčková M, Milerová M, et al. N-acetylcysteine treatment prevents the up-regulation of MnSOD in chronically hypoxic rat hearts[J]. Physiol Res, 2011, 60(3): 467–474. https://www.biomed.cas.cz/physiolres/pdf/60/60_467.pdf
    [123]
    Heusch G. Molecular basis of cardioprotection: signal transduction in ischemic pre-, post-, and remote conditioning[J]. Circ Res, 2015, 116(4): 674–699. doi: 10.1161/CIRCRESAHA.116.305348
    [124]
    Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs[J]. Annu Rev Biochem, 2010, 79: 351–379. doi: 10.1146/annurev-biochem-060308-103103
    [125]
    McCreight JC, Schneider SE, Wilburn DB, et al. Evolution of microRNA in primates[J]. PLoS One, 2017, 12(6): e0176596. doi: 10.1371/journal.pone.0176596
    [126]
    Tsibulnikov SY, Maslov LN, Gorbunov AS, et al. A review of humoral factors in remote preconditioning of the heart[J]. J Cardiovasc Pharmacol Ther, 2019, 24(5): 403–421. doi: 10.1177/1074248419841632
    [127]
    Chen Y, Ye X, Yan F. MicroRNA 3113-5p is a novel marker for early cardiac ischemia/reperfusion injury[J]. Diagn Pathol, 2019, 14(1): 121. doi: 10.1186/s13000-019-0894-1
    [128]
    He S, Liu P, Jian Z, et al. miR-138 protects cardiomyocytes from hypoxia-induced apoptosis via MLK3/JNK/c-Jun pathway[J]. Biochem Biophys Res Commun, 2013, 441(4): 763–769. doi: 10.1016/j.bbrc.2013.10.151
    [129]
    Chen Q, Huang J, Wang H, et al. Effects of chronic intermittent hypoxia on regulation of miRNA-214 in myocardial apoptosis in rats[J]. Natl Med J China, 2015, 95(16): 1214–1217. http://rs.yiigle.com/CN112137201516/146750.htm
    [130]
    Huang J, Li X, Li H, et al. Down-regulation of microRNA-184 contributes to the development of cyanotic congenital heart diseases[J]. Int J Clin Exp Pathol, 2015, 8(11): 14221–14227. https://pubmed.ncbi.nlm.nih.gov/26823736/
    [131]
    Zhou Y, Jia W, Jian Z, et al. Downregulation of microRNA-199a-5p protects cardiomyocytes in cyanotic congenital heart disease by attenuating endoplasmic reticulum stress[J]. Mol Med Rep, 2017, 16(3): 2992–3000. doi: 10.3892/mmr.2017.6934
    [132]
    He W, Che H, Jin C, et al. Effects of miR-23b on hypoxia-induced cardiomyocytes apoptosis[J]. Biomed Pharmacother, 2017, 96: 812–817. doi: 10.1016/j.biopha.2017.09.148
    [133]
    Ren J, Liu W, Li G, et al. Atorvastatin attenuates myocardial hypertrophy induced by chronic intermittent hypoxia in vitro partly through miR-31/PKCε pathway[J]. Curr Med Sci, 2018, 38(3): 405–412. doi: 10.1007/s11596-018-1893-2
    [134]
    Zhang K, Ma Z, Wang W, et al. Beneficial effects of tolvaptan on atrial remodeling induced by chronic intermittent hypoxia in rats[J]. Cardiovasc Ther, 2018, 36(6): e12466. doi: 10.1111/1755-5922.12466
    [135]
    Santolini J. What does "NO-synthase" stand for ?[J]. Front Biosci, 2019, 24(1): 133–171. doi: 10.2741/4711
    [136]
    Cohen MV, Downey JM. Signalling pathways and mechanisms of protection in pre- and postconditioning: historical perspective and lessons for the future[J]. Br J Pharmacol, 2015, 172(8): 1913–1932. doi: 10.1111/bph.12903
    [137]
    Ferreiro CR, Chagas ACP, Carvalho MHC, et al. Influence of hypoxia on nitric oxide synthase activity and gene expression in children with congenital heart disease: a novel pathophysiological adaptive mechanism[J]. Circulation, 2001, 103(18): 2272–2276. doi: 10.1161/01.CIR.103.18.2272
    [138]
    Grilli A, De Lutiis MA, Patruno A, et al. Inducible nitric oxide synthase and heme oxygenase-1 in rat heart: direct effect of chronic exposure to hypoxia[J]. Ann Clin Lab Sci, 2003, 33(2): 208–215. http://www.annclinlabsci.org/content/33/2/208.long
    [139]
    Jung F, Palmer LA, Zhou N, et al. Hypoxic regulation of inducible nitric oxide synthase via hypoxia inducible factor-1 in cardiac myocytes[J]. Circ Res, 2000, 86(3): 319–325. doi: 10.1161/01.RES.86.3.319
    [140]
    Rouet-Benzineb P, Eddahibi S, Raffestin B, et al. Induction of cardiac nitric oxide synthase 2 in rats exposed to chronic hypoxia[J]. J Mol Cell Cardiol, 1999, 31(9): 1697–1708. doi: 10.1006/jmcc.1999.1005
    [141]
    Yuan X, Zhu D, Guo X, et al. Telmisartan attenuates myocardial apoptosis induced by chronic intermittent hypoxia in rats: modulation of nitric oxide metabolism and inflammatory mediators[J]. Sleep Breath, 2015, 19(2): 703–709. doi: 10.1007/s11325-014-1081-y
    [142]
    Thompson LP, Dong Y. Chronic hypoxia decreases endothelial nitric oxide synthase protein expression in fetal guinea pig hearts[J]. J Soc Gynecol Investig, 2005, 12(6): 388–395. doi: 10.1016/j.jsgi.2005.04.011
    [143]
    La Padula PH, Etchegoyen M, Czerniczyniec A, et al. Cardioprotection after acute exposure to simulated high altitude in rats. Role of nitric oxide[J]. Nitric Oxide, 2018, 73: 52–59. doi: 10.1016/j.niox.2017.12.007
    [144]
    Felaco M, Grilli A, Gorbunov N, et al. Endothelial NOS expression and ischemia-reperfusion in isolated working rat heart from hypoxic and hyperoxic conditions[J]. Biochim Biophys Acta, 2000, 1524(2-3): 203–211. doi: 10.1016/S0304-4165(00)00159-8
    [145]
    Forkel J, Chen X, Wandinger S, et al. Responses of chronically hypoxic rat hearts to ischemia: KATP channel blockade does not abolish increased RV tolerance to ischemia[J]. Am J Physiol Heart Circ Physiol, 2004, 286(2): H545–H551. doi: 10.1152/ajpheart.00022.2003
    [146]
    Quing M, Görlach A, Schumacher K, et al. The hypoxia-inducible factor HIF-1 promotes intramyocardial expression of VEGF in infants with congenital cardiac defects[J]. Basic Res Cardiol, 2007, 102(3): 224–232. doi: 10.1007/s00395-007-0639-2
    [147]
    Shi Y, Pritchard KA, Holman P, et al. Chronic myocardial hypoxia increases nitric oxide synthase and decreases caveolin-3[J]. Free Radic Biol Med, 2000, 29(8): 695–703. doi: 10.1016/S0891-5849(00)00364-6
    [148]
    La Padula P, Bustamante J, Czerniczyniec A, et al. Time course of regression of the protection conferred by simulated high altitude to rat myocardium: correlation with mtNOS[J]. J Appl Physiol, 2008, 105(3): 951–957. doi: 10.1152/japplphysiol.90400.2008
    [149]
    Ghafourifar P, Cadenas E. Mitochondrial nitric oxide synthase[J]. Trends Pharmacol Sci, 2005, 26(4): 190–195. doi: 10.1016/j.tips.2005.02.005
    [150]
    Thompson L, Dong Y, Evans L. Chronic hypoxia increases inducible NOS-derived nitric oxide in fetal guinea pig hearts[J]. Pediatr Res, 2009, 65(2): 188–192. doi: 10.1203/PDR.0b013e31818d6ad0
    [151]
    Milano G, Corno AF, Samaja M, et al. Daily reoxygenation decreases myocardial injury and improves post-ischaemic recovery after chronic hypoxia[J]. Eur J Cardiothorac Surg, 2010, 37(4): 942–949. doi: 10.1016/j.ejcts.2009.10.030
    [152]
    Yu X, Ge L, Niu L, et al. The dual role of inducible nitric oxide synthase in myocardial ischemia/reperfusion injury: friend or foe?[J]. Oxid Med Cell Longev, 2018, 2018: 8364848. doi: 10.1155/2018/8364848
    [153]
    Baker JE, Holman P, Kalyanaraman B, et al. Adaptation to chronic hypoxia confers tolerance to subsequent myocardial ischemia by increased nitric oxide production[J]. Ann N Y Acad Sci, 1999, 874: 236–253. doi: 10.1111/j.1749-6632.1999.tb09239.x
    [154]
    Earley S, Walker BR. Increased nitric oxide production following chronic hypoxia contributes to attenuated systemic vasoconstriction[J]. Am J Physiol Heart Circ Physiol, 2003, 284(5): H1655–H1661. doi: 10.1152/ajpheart.00964.2002
    [155]
    Fitzpatrick CM, Shi Y, Hutchins WC, et al. Cardioprotection in chronically hypoxic rabbits persists on exposure to normoxia: role of NOS and KATP channels[J]. Am J Physiol Heart Circ Physiol, 2005, 288(1): H62–H68. doi: 10.1152/ajpheart.00701.2004
    [156]
    Rafiee P, Shi Y, Kong X, et al. Activation of protein kinases in chronically hypoxic infant human and rabbit hearts: role in cardioprotection[J]. Circulation, 2002, 106(2): 239–245. doi: 10.1161/01.CIR.0000022018.68965.6D
    [157]
    Morel OE, Buvry A, Le Corvoisier P, et al. Effects of nifedipine-induced pulmonary vasodilatation on cardiac receptors and protein kinase C isoforms in the chronically hypoxic rat[J]. Pflugers Arch, 2003, 446(3): 356–364. doi: 10.1007/s00424-003-1034-y
    [158]
    Naryzhnaya NV, Maslov IN, Khaliulin IG, et al. Chronic continuous nor-Mobaric hypoxia augments cell tolerance to anoxia (reoxyge-nation: the role of protein kinases[J]. Ross Fiziol Zh Im I M Sechenova (in Russian), 2016, 102(12): 1462–1471. https://pubmed.ncbi.nlm.nih.gov/30198641/
    [159]
    El Alwani M, Usta J, Nemer G, et al. Regulation of the sphingolipid signaling pathways in the growing and hypoxic rat heart[J]. Prostaglandins Other Lipid Mediat, 2005, 78(1–4): 249–263. doi: 10.1016/j.prostaglandins.2005.09.002
    [160]
    Hlaváčková M, Kožichová K, Neckář J, et al. Up-regulation and redistribution of protein kinase C-δ in chronically hypoxic heart[J]. Mol Cell Biochem, 2010, 345(1-2): 271–282. doi: 10.1007/s11010-010-0581-8
    [161]
    Hlavácková M, Neckár J, Jezková J, et al. Dietary polyunsaturated fatty acids alter myocardial protein kinase C expression and affect cardioprotection induced by chronic hypoxia[J]. Exp Biol Med, 2007, 232(6): 823–832. https://pubmed.ncbi.nlm.nih.gov/17526775/
    [162]
    Su Z, Liu Y, Zhang H. Adaptive cardiac metabolism under chronic hypoxia: mechanism and clinical implications[J]. Front Cell Dev Biol, 2021, 9: 625524. doi: 10.3389/fcell.2021.625524
    [163]
    de Miranda DC, de Oliveira Faria G, Hermidorff MM, et al. Pre- and post-conditioning of the heart: an overview of cardioprotective signaling pathways[J]. Curr Vasc Pharmacol, 2021, 19(5): 499–524. doi: 10.2174/1570161119666201120160619
    [164]
    Micova P, Hahnova K, Hlavackova M, et al. Chronic intermittent hypoxia affects the cytosolic phospholipase A2α/cyclooxygenase 2 pathway via β2-adrenoceptor-mediated ERK/p38 stimulation[J]. Mol Cell Biochem, 2016, 423(1-2): 151–163. doi: 10.1007/s11010-016-2833-8
    [165]
    Zeng C, Liang B, Jiang R, et al. Protein kinase C isozyme expression in right ventricular hypertrophy induced by pulmonary hypertension in chronically hypoxic rats[J]. Mol Med Rep, 2017, 16(4): 3833–3840. doi: 10.3892/mmr.2017.7098
    [166]
    Ling H, Gray CBB, Zambon AC, et al. Ca2+/calmodulin-dependent protein kinase II δ mediates myocardial ischemia/reperfusion injury through nuclear factor-κB[J]. Circ Res, 2013, 112(6): 935–944. doi: 10.1161/CIRCRESAHA.112.276915
    [167]
    Yang Y, Jiang K, Liu X, et al. CaMKII in regulation of cell death during myocardial reperfusion injury[J]. Front Mol Biosci, 2021, 8: 668129. doi: 10.3389/fmolb.2021.668129
    [168]
    Zhao P, Pan J, Li F, et al. Effects of chronic hypoxia on the expression of calmodulin and calcicum/calmodulin-dependent protein kinase II and the calcium activity in myocardial cells in young rats[J]. Chin J Contemp Pediatr, 2008, 10(3): 381–385. https://d.wanfangdata.com.cn/periodical/zgddekzz200803028
    [169]
    Nehra S, Bhardwaj V, Kar S, et al. Chronic hypobaric hypoxia induces right ventricular hypertrophy and apoptosis in rats: therapeutic potential of nanocurcumin in improving adaptation[J]. High Alt Med Biol, 2016, 17(4): 342–352. doi: 10.1089/ham.2016.0032
    [170]
    Xie Y, Zhu W, Zhu Y, et al. Intermittent high altitude hypoxia protects the heart against lethal Ca2+ overload injury[J]. Life Sci, 2004, 76(5): 559–572. doi: 10.1016/j.lfs.2004.09.017
    [171]
    Gui L, Guo X, Zhang Z, et al. Activation of CaMKIIδA promotes Ca2+ leak from the sarcoplasmic reticulum in cardiomyocytes of chronic heart failure rats[J]. Acta Pharmacol Sin, 2018, 39(10): 1604–1612. doi: 10.1038/aps.2018.20
    [172]
    Strnisková M, Ravingerová T, Neckár J, et al. Changes in the expression and/or activation of regulatory proteins in rat hearts adapted to chronic hypoxia[J]. Gen Physiol Biophys, 2006, 25(1): 25–41. http://www.gpb.sav.sk/2006_01_25.pdf
    [173]
    Milano G, von Segesser LK, Morel S, et al. Phosphorylation of phosphatidylinositol-3-kinase-protein kinase B and extracellular signal-regulated kinases 1/2 mediate reoxygenation-induced cardioprotection during hypoxia[J]. Exp Biol Med, 2010, 235(3): 401–410. doi: 10.1258/ebm.2009.009153
    [174]
    Ravingerová T, Matejíková J, Neckář J, et al. Differential role of PI3K/Akt pathway in the infarct size limitation and antiarrhythmic protection in the rat heart[J]. Mol Cell Biochem, 2007, 297(1-2): 111–120. doi: 10.1007/s11010-006-9335-z
    [175]
    Jia W, Jian Z, Li J, et al. Upregulated ATF6 contributes to chronic intermittent hypoxia-afforded protection against myocardial ischemia/reperfusion injury[J]. Int J Mol Med, 2016, 37(5): 1199–1208. doi: 10.3892/ijmm.2016.2535
    [176]
    Luo G, Jian Z, Ma R, et al. Melatonin alleviates hypoxia-induced cardiac apoptosis through PI3K/Akt pathway[J]. Int J Clin Exp Pathol, 2018, 11(12): 5840–5849. https://pubmed.ncbi.nlm.nih.gov/31949670/
    [177]
    García-Niño WR, Zazueta C, Buelna-Chontal M, et al. Mitochondrial quality control in cardiac-conditioning strategies against ischemia-reperfusion injury[J]. Life (Basel), 2021, 11(11): 1123. doi: 10.3390/LIFE11111123
    [178]
    Morel S, Milano G, Ludunge KM, et al. Brief reoxygenation episodes during chronic hypoxia enhance posthypoxic recovery of LV function: role of mitogen-activated protein kinase signaling pathways[J]. Basic Res Cardiol, 2006, 101(4): 336–345. doi: 10.1007/s00395-006-0596-1
    [179]
    Milano G, Morel S, Bonny C, et al. A peptide inhibitor of c-Jun NH2-terminal kinase reduces myocardial ischemia-reperfusion injury and infarct size in vivo[J]. Am J Physiol Heart Circ Physiol, 2007, 292(4): H1828–H1835. doi: 10.1152/ajpheart.01117.2006
    [180]
    Heidbreder M, Naumann A, Tempel K, et al. Remote vs. ischaemic preconditioning: the differential role of mitogen-activated protein kinase pathways[J]. Cardiovasc Res, 2008, 78(1): 108–115. doi: 10.1093/cvr/cvm114
    [181]
    Menon VP, Sudheer AR. Antioxidant and anti-inflammatory properties of curcumin[M]//Aggarwal BB, Surh YJ, Shishodia S. The Molecular Targets and Therapeutic Uses of Curcumin in Health and Disease. New York: Springer, 2007: 105–125.
    [182]
    Li Q, Xiang Y, Chen Y, et al. Ginsenoside Rg1 protects cardiomyocytes against hypoxia/reoxygenation injury via activation of Nrf2/HO-1 signaling and inhibition of JNK[J]. Cell Physiol Biochem, 2017, 44(1): 21–37. doi: 10.1159/000484578
    [183]
    He S, Liu S, Wu X, et al. Protective role of downregulated MLK3 in myocardial adaptation to chronic hypoxia[J]. J Physiol Biochem, 2016, 73(3): 371–380. doi: 10.1007/s13105-017-0561-5
    [184]
    Zhao Y, An J, Yang S, et al. Hydrogen and oxygen mixture to improve cardiac dysfunction and myocardial pathological changes induced by intermittent hypoxia in rats[J]. Oxid Med Cell Longev, 2019, 2019: 7415212. doi: 10.1155/2019/7415212
    [185]
    Wagner C, Tillack D, Simonis G, et al. Ischemic post-conditioning reduces infarct size of the in vivo rat heart: role of PI3-K, mTOR, GSK-3β, and apoptosis[J]. Mol Cell Biochem, 2010, 339(1-2): 135–147. doi: 10.1007/s11010-009-0377-x
    [186]
    Li W, Zhu L, Ruan Z, et al. Nicotinamide protects chronic hypoxic myocardial cells through regulating mTOR pathway and inducing autophagy[J]. Eur Rev Med Pharmacol Sci, 2019, 23(12): 5503–5511. https://www.europeanreview.org/wp/wp-content/uploads/5503-5511.pdf
    [187]
    Guan P, Sun ZM, Wang N, et al. Resveratrol prevents chronic intermittent hypoxia-induced cardiac hypertrophy by targeting the PI3K/AKT/mTOR pathway[J]. Life Sci, 2019, 233: 116748. doi: 10.1016/j.lfs.2019.116748
    [188]
    Wang J, Maimaitili Y, Zheng H, et al. The influence of rapamycin on the early cardioprotective effect of hypoxic preconditioning on cardiomyocytes[J]. Arch Med Sci, 2017, 13(4): 947–955. doi: 10.5114/aoms.2016.59712
    [189]
    Gu S, Hua H, Guo X, et al. PGC-1α Participates in the protective effect of chronic intermittent hypobaric hypoxia on cardiomyocytes[J]. Cell Physiol Biochem, 2018, 50(5): 1891–1902. doi: 10.1159/000494869
    [190]
    Zhang H, Liu B, Li T, et al. AMPK activation serves a critical role in mitochondria quality control via modulating mitophagy in the heart under chronic hypoxia[J]. Int J Mol Med, 2018, 41(1): 69–76. https://pubmed.ncbi.nlm.nih.gov/29115402/
    [191]
    Miura T, Miki T. GSK-3β, a therapeutic target for cardiomyocyte protection[J]. Circ J, 2009, 73(7): 1184–1192. doi: 10.1253/circj.CJ-09-0284
    [192]
    McCarthy J, Lochner A, Opie LH, et al. PKCε promotes cardiac mitochondrial and metabolic adaptation to chronic hypobaric hypoxia by GSK3β inhibition[J]. J Cell Physiol, 2011, 226(9): 2457–2468. doi: 10.1002/jcp.22592
    [193]
    Waskova-Arnostova P, Elsnicova B, Kasparova D, et al. Cardioprotective adaptation of rats to intermittent hypobaric hypoxia is accompanied by the increased association of hexokinase with mitochondria[J]. J Appl Physiol, 2015, 119(12): 1487–1493. doi: 10.1152/japplphysiol.01035.2014
    [194]
    Gross GJ, Peart JN. KATP channels and myocardial preconditioning: an update[J]. Am J Physiol Heart Circ Physiol, 2003, 285(3): H921–H930. doi: 10.1152/ajpheart.00421.2003
    [195]
    Grover GJ, Garlid KD. ATP-sensitive potassium channels: a review of their cardioprotective pharmacology[J]. J Mol Cell Cardiol, 2000, 32(4): 677–695. doi: 10.1006/jmcc.2000.1111
    [196]
    Peart JN, Gross GJ. Sarcolemmal and mitochondrial KATP channels and myocardial ischemic preconditioning[J]. J Cell Mol Med, 2002, 6(4): 453–464. doi: 10.1111/j.1582-4934.2002.tb00449.x
    [197]
    Baker JE, Contney SJ, Gross GJ, et al. KATP channel activation in a rabbit model of chronic myocardial hypoxia[J]. J Mol Cell Cardiol, 1997, 29(2): 845–848. doi: 10.1006/jmcc.1996.0361
    [198]
    Zhu Z, Burnett CM, Maksymov G, et al. Reduction in number of sarcolemmal KATP channels slows cardiac action potential duration shortening under hypoxia[J]. Biochem Biophys Res Commun, 2011, 415(4): 637–641. doi: 10.1016/j.bbrc.2011.10.125
    [199]
    Crawford RM, Jovanović S, Budas GR, et al. Chronic mild hypoxia protects heart-derived H9c2 cells against acute hypoxia/reoxygenation by regulating expression of the SUR2A subunit of the ATP-sensitive K+ channel[J]. J Biol Chem, 2003, 278(33): 31444–31455. doi: 10.1074/jbc.M303051200
    [200]
    Kolar F, Nekar J, Ostadal B, et al. Role of ATP-sensitive K+-channels in antiarrhythmic and cardioprotective action of adaptation to intermittent hypobaric hypoxia[J]. Bull Exp Biol Med, 2008, 145(4): 418–421. doi: 10.1007/s10517-008-0106-6
    [201]
    Neckář J, Szárszoi O, Koten L, et al. Effects of mitochondrial KATP modulators on cardioprotection induced by chronic high altitude hypoxia in rats[J]. Cardiovasc Res, 2002, 55(3): 567–575. doi: 10.1016/S0008-6363(02)00456-X
    [202]
    Lishmanov YB, Naryzhnaya NV, Tsibul’nikov SY, et al. Role of ATP-sensitive K+ channels in myocardial infarct size-limiting effect of chronic continuous normobaric hypoxia[J]. Bull Exp Biol Med, 2017, 163(1): 22–24. doi: 10.1007/s10517-017-3728-8
    [203]
    Testai L, Rapposelli S, Martelli A, et al. Mitochondrial potassium channels as pharmacological target for cardioprotective drugs[J]. Med Res Rev, 2015, 35(3): 520–553. doi: 10.1002/med.21332
    [204]
    Semenza GL. Pharmacologic targeting of hypoxia-inducible factors[J]. Annu Rev Pharmacol Toxicol, 2019, 59: 379–403. doi: 10.1146/annurev-pharmtox-010818-021637
    [205]
    Li J, Zhou W, Chen W, et al. Mechanism of the hypoxia inducible factor 1/hypoxic response element pathway in rat myocardial ischemia/diazoxide post-conditioning[J]. Mol Med Rep, 2020, 21(3): 1527–1536. doi: 10.3892/mmr.2020.10966
    [206]
    Lin C, Hsu KC, Huangfu W, et al. Investigating the potential effects of selective histone deacetylase 6 inhibitor ACY1215 on infarct size in rats with cardiac ischemia-reperfusion injury[J]. BMC Pharmacol Toxicol, 2020, 21(1): 21. doi: 10.1186/s40360-020-0400-0
    [207]
    Wang Z, Zhang Z, Zhao J, et al. Polysaccharides from enteromorpha prolifera ameliorate acute myocardial infarction in vitro and in vivo via up-regulating HIF-1α[J]. Int Heart J, 2019, 60(4): 964–973. doi: 10.1536/ihj.18-519
    [208]
    Wei Q, Bian Y, Yu F, et al. Chronic intermittent hypoxia induces cardiac inflammation and dysfunction in a rat obstructive sleep apnea model[J]. J Biomed Res, 2016, 30(6): 490–495. doi: 10.7555/JBR.30.20160110
    [209]
    Sarkar FH, Li Y, Wang Z, et al. NF-κB signaling pathway and its therapeutic implications in human diseases[J]. Int Rev Immunol, 2008, 27(5): 293–319. doi: 10.1080/08830180802276179
    [210]
    Morgan EN, Boyle EM, Yun W, et al. An essential role for NF-κB in the cardioadaptive response to ischemia[J]. Ann Thorac Surg, 1999, 68(2): 377–382. doi: 10.1016/S0003-4975(99)00646-3
    [211]
    Yuan C, Wang H, Yuan Z. Ginsenoside Rg1 inhibits myocardial ischaemia and reperfusion injury via HIF-1 α-ERK signalling pathways in a diabetic rat model[J]. Pharmazie, 2019, 74(3): 157–162. https://pubmed.ncbi.nlm.nih.gov/30961682/
    [212]
    Liu D, Zhang Y, Hu H, et al. Downregulation of microRNA-199a-5p attenuates hypoxia/reoxygenation-induced cytotoxicity in cardiomyocytes by targeting the HIF-1α-GSK3β-mPTP axis[J]. Mol Med Rep, 2019, 19(6): 5335–5344. https://www.spandidos-publications.com/mmr/19/6/5335
    [213]
    Dong J, Xu M, Zhang W, et al. Effects of sevoflurane pretreatment on myocardial ischemia-reperfusion injury through the Akt/hypoxia-inducible factor 1-alpha (HIF-1α)/vascular endothelial growth factor (VEGF) signaling pathway[J]. Med Sci Monit, 2019, 25: 3100–3107. doi: 10.12659/MSM.914265
    [214]
    Jiang L, Zeng H, Ni L, et al. HIF-1α preconditioning potentiates antioxidant activity in ischemic injury: the role of sequential administration of dihydrotanshinone I and protocatechuic aldehyde in cardioprotection[J]. Antioxid Redox Signal, 2019, 31(3): 227–242. doi: 10.1089/ars.2018.7624
    [215]
    Tranter M, Ren X, Forde T, et al. NF-κB driven cardioprotective gene programs; Hsp70.3 and cardioprotection after late ischemic preconditioning[J]. J Mol Cell Cardiol, 2010, 49(4): 664–672. doi: 10.1016/j.yjmcc.2010.07.001
    [216]
    Wilhide ME, Tranter M, Ren X, et al. Identification of a NF-κB cardioprotective gene program: NF-κB regulation of Hsp70.1 contributes to cardioprotection after permanent coronary occlusion[J]. J Mol Cell Cardiol, 2011, 51(1): 82–89. doi: 10.1016/j.yjmcc.2011.03.011
    [217]
    Stein AB, Bolli R, Dawn B, et al. Carbon monoxide induces a late preconditioning-mimetic cardioprotective and antiapoptotic milieu in the myocardium[J]. J Mol Cell Cardiol, 2012, 52(1): 228–236. doi: 10.1016/j.yjmcc.2011.11.005
    [218]
    Qiao S, Xie H, Wang C, et al. Delayed anesthetic preconditioning protects against myocardial infarction via activation of nuclear factor-κB and upregulation of autophagy[J]. J Anesth, 2013, 27(2): 251–260. doi: 10.1007/s00540-012-1494-3
    [219]
    Haar L, Ren X, Liu Y, et al. Acute consumption of a high-fat diet prior to ischemia-reperfusion results in cardioprotection through NF-κB-dependent regulation of autophagic pathways[J]. Am J Physiol Heart Circ Physiol, 2014, 307(12): H1705–H1713. doi: 10.1152/ajpheart.00271.2014
    [220]
    Naryzhnaya NV, Maslov LN, Oeltgen PR. Pharmacology of mitochondrial permeability transition pore inhibitors[J]. Drug Dev Res, 2019, 80(8): 1013–1030. doi: 10.1002/ddr.21593
    [221]
    Armstrong SC, Liu GS, Downey JM, et al. Potassium channels and preconditioning of isolated rabbit cardiomyocytes: effects of glyburide and pinacidil[J]. J Mol Cell Cardiol, 1995, 27(8): 1765–1774. doi: 10.1016/S0022-2828(95)90986-9
    [222]
    Xu M, Wang Y, Ayub A, et al. Mitochondrial KATP channel activation reduces anoxic injury by restoring mitochondrial membrane potential[J]. Am J Physiol Heart Circ Physiol, 2001, 281(3): H1295–H1303. doi: 10.1152/ajpheart.2001.281.3.H1295
    [223]
    Hausenloy DJ, Schulz R, Girao H, et al. Mitochondrial ion channels as targets for cardioprotection[J]. J Cell Mol Med, 2020, 24(13): 7102–7114. doi: 10.1111/jcmm.15341
    [224]
    Ozcan C, Bienengraeber M, Dzeja PP, et al. Potassium channel openers protect cardiac mitochondria by attenuating oxidant stress at reoxygenation[J]. Am J Physiol Heart Circ Physiol, 2002, 282(2): H531–H539. doi: 10.1152/ajpheart.00552.2001
    [225]
    Ichinose M, Yonemochi H, Sato T, et al. Diazoxide triggers cardioprotection against apoptosis induced by oxidative stress[J]. Am J Physiol Heart Circ Physiol, 2003, 284(6): H2235–H2241. doi: 10.1152/ajpheart.01073.2002
    [226]
    Jung YS, Lee DH, Lim H, et al. KR-31378 protects cardiac H9c2 cells from chemical hypoxia-induced cell death via inhibition of JNK/p38 MAPK activation[J]. Jpn J Physiol, 2004, 54(6): 575–583. doi: 10.2170/jjphysiol.54.575
    [227]
    Obata T, Yamanaka Y. Block of cardiac atp-sensitive K+ channels reduces hydroxyl radicals in the rat myocardium[J]. Arch Biochem Biophys, 2000, 378(2): 195–200. doi: 10.1006/abbi.2000.1830
    [228]
    Pain T, Yang XM, Critz SD, et al. Opening of mitochondrial KATP channels triggers the preconditioned state by generating free radicals[J]. Circ Res, 2000, 87(6): 460–466. doi: 10.1161/01.RES.87.6.460
    [229]
    Carroll R, Gant VA, Yellon DM. Mitochondrial KATP channel opening protects a human atrial-derived cell line by a mechanism involving free radical generation[J]. Cardiovasc Res, 2001, 51(4): 691–700. doi: 10.1016/S0008-6363(01)00330-3
    [230]
    Forbes RA, Steenbergen C, Murphy E. Diazoxide-induced cardioprotection requires signaling through a redox-sensitive mechanism[J]. Circ Res, 2001, 88(8): 802–809. doi: 10.1161/hh0801.089342
    [231]
    Tsuchida A, Miura T, Tanno M, et al. Infarct size limitation by nicorandil: roles of mitochondrial KATP channels, sarcolemmal KATP channels, and protein kinase C[J]. J Am Coll Cardiol, 2002, 40(8): 1523–1530. doi: 10.1016/S0735-1097(02)02268-4
    [232]
    Wang Y, Hirai K, Ashraf M. Activation of mitochondrial ATP-sensitive K+ channel for cardiac protection against ischemic injury is dependent on protein kinase C activity[J]. Circ Res, 1999, 85(8): 731–741. doi: 10.1161/01.RES.85.8.731
    [233]
    Wang Y, Takashi E, Xu M, et al. Downregulation of protein kinase C inhibits activation of mitochondrial KATP channels by diazoxide[J]. Circulation, 2001, 104(1): 85–90. doi: 10.1161/01.CIR.104.1.85
    [234]
    Tsukamoto O, Asanuma H, Kim J, et al. A role of opening of mitochondrial ATP-sensitive potassium channels in the infarct size-limiting effect of ischemic preconditioning via activation of protein kinase C in the canine heart[J]. Biochem Biophys Res Commun, 2005, 338(3): 1460–1466. doi: 10.1016/j.bbrc.2005.10.109
    [235]
    Akao M, Teshima Y, Marbán E. Antiapoptotic effect of nicorandil mediated by mitochondrial atp-sensitive potassium channels in cultured cardiac myocytes[J]. J Am Coll Cardiol, 2002, 40(4): 803–810. doi: 10.1016/S0735-1097(02)02007-7
    [236]
    Gao Q, Pan H, Qiu S, et al. Atractyloside and 5-hydroxydecanoate block the protective effect of puerarin in isolated rat heart[J]. Life Sci, 2006, 79(3): 217–224. doi: 10.1016/j.lfs.2005.12.040
    [237]
    Gross ER, Hsu AK, Gross GJ. Delayed cardioprotection afforded by the glycogen synthase kinase 3 inhibitor SB-216763 occurs via a KATP- and MPTP-dependent mechanism at reperfusion[J]. Am J Physiol Heart Circ Physiol, 2008, 294(3): H1497–H1500. doi: 10.1152/ajpheart.01381.2007
    [238]
    Bu H, Yang C, Wang M, et al. KATP channels and MPTP are involved in the cardioprotection bestowed by chronic intermittent hypobaric hypoxia in the developing rat[J]. J Physiol Sci, 2015, 65(4): 367–376. doi: 10.1007/s12576-015-0376-5
    [239]
    Topsakal R, Eryol NK, Abacı A, et al. The relation between chronic obstructive pulmonary disease and coronary collateral vessels[J]. Angiology, 2005, 56(6): 651–656. doi: 10.1177/000331970505600601
    [240]
    Tin'kov AN, Aksenov VA. Effects of intermittent hypobaric hypoxia on blood lipid concentrations in male coronary heart disease patients[J]. High Alt Med Biol, 2002, 3(3): 277–282. doi: 10.1089/152702902320604250
    [241]
    del Pilar Valle M, García-Godos F, Woolcott OO, et al. Improvement of myocardial perfusion in coronary patients after intermittent hypobaric hypoxia[J]. J Nucl Cardiol, 2006, 13(1): 69–74. doi: 10.1016/j.nuclcard.2005.11.008
    [242]
    Syrkin AL, Glazachev OS, Kopylov FY, et al. Adaptation to intermittent hypoxia-hyperoxia in the rehabilitation of patients with ischemic heart disease: exercise tolerance and quality of life[J]. Kardiologiia (in Russian), 2017, 57(5): 10–16. https://pubmed.ncbi.nlm.nih.gov/28762914/
    [243]
    Glazachev O, Kopylov P, Susta D, et al. Adaptations following an intermittent hypoxia-hyperoxia training in coronary artery disease patients: a controlled study[J]. Clin Cardiol, 2017, 40(6): 370–376. doi: 10.1002/clc.22670
    • Related Articles

  • Related Articles

    [1]Tiwari-Heckler Shilpa, Jiang Z. Gordon, Popov Yury, J. Mukamal Kenneth. Daily high-dose aspirin does not lower APRI in the Aspirin-Myocardial Infarction Study[J]. The Journal of Biomedical Research, 2020, 34(2): 139-142. DOI: 10.7555/JBR.33.20190041
    [2]Tao Chun'ai, Gan Yongxin, Su Weidong, Li Zhutian, Tang Xiaolan. Effectiveness of hospital disinfection and experience learnt from 11 years of surveillance[J]. The Journal of Biomedical Research, 2019, 33(6): 408-413. DOI: 10.7555/JBR.33.20180118
    [3]Huan Liu, Shijiang Zhang, Yongfeng Shao, Xiaohu Lu, Weidong Gu, Buqing Ni, Qun Gu, Junjie Du. Biomechanical characterization of a novel ring connector for sutureless aortic anastomosis[J]. The Journal of Biomedical Research, 2018, 32(6): 454-460. DOI: 10.7555/JBR.31.20170011
    [4]Minbo Zang, Qiao Zhou, Yunfei Zhu, Mingxi Liu, Zuomin Zhou. Effects of chemotherapeutic agent bendamustine for nonhodgkin lymphoma on spermatogenesis in mice[J]. The Journal of Biomedical Research, 2018, 32(6): 442-453. DOI: 10.7555/JBR.31.20170023
    [5]Kaibo Lin, Shikun Zhang, Jieli Chen, Ding Yang, Mengyi Zhu, Eugene Yujun Xu. Generation and functional characterization of a conditional Pumilio2 null allele[J]. The Journal of Biomedical Research, 2018, 32(6): 434-441. DOI: 10.7555/JBR.32.20170117
    [6]Huanqiang Wang, Congying Yang, Siyuan Wang, Tian Wang, Jingling Han, Kai Wei, Fucun Liu, Jida Xu, Xianzhen Peng, Jianming Wang. Cell-free plasma hypermethylated CASZ1, CDH13 and ING2 are promising biomarkers of esophageal cancer[J]. The Journal of Biomedical Research, 2018, 32(6): 424-433. DOI: 10.7555/JBR.32.20170065
    [7]Fengzhen Wang, Mingwan Zhang, Dongsheng Zhang, Yuan Huang, Li Chen, Sunmin Jiang, Kun Shi, Rui Li. Preparation, optimization, and characterization of chitosancoated solid lipid nanoparticles for ocular drug delivery[J]. The Journal of Biomedical Research, 2018, 32(6): 411-423. DOI: 10.7555/JBR.32.20160170
    [8]Christopher J. Danford, Zemin Yao, Z. Gordon Jiang. Non-alcoholic fatty liver disease: a narrative review of genetics[J]. The Journal of Biomedical Research, 2018, 32(6): 389-400. DOI: 10.7555/JBR.32.20180045
    [9]Qin Wei, Yeping Bian, Fuchao Yu, Qiang Zhang, Guanghao Zhang, Yang Li, Songsong Song, Xiaomei Ren, Jiayi Tong. Chronic intermittent hypoxia induces cardiac inflammation and dysfunction in a rat obstructive sleep apnea model[J]. The Journal of Biomedical Research, 2016, 30(6): 490-495. DOI: 10.7555/JBR.30.20160110
    [10]Weihua Zhou, Ji Chen. I -123 metaiodobenzylguanidine imaging for predicting ventricular arrhythmia in heart failure patients[J]. The Journal of Biomedical Research, 2013, 27(6): 460-466. DOI: 10.7555/JBR.27.20130137

  • Cited by

    Periodical cited type(3)

    1. Boshchenko AA, Maslov LN, Mukhomedzyanov AV, et al. Peptides Are Cardioprotective Drugs of the Future: The Receptor and Signaling Mechanisms of the Cardioprotective Effect of Glucagon-like Peptide-1 Receptor Agonists. Int J Mol Sci, 2024, 25(9): 4900. DOI:10.3390/ijms25094900
    2. Tallo FS, de Santana PO, Pinto SAG, et al. Pharmacological Modulation of the Ca2+/cAMP/Adenosine Signaling in Cardiac Cells as a New Cardioprotective Strategy to Reduce Severe Arrhythmias in Myocardial Infarction. Pharmaceuticals (Basel), 2023, 16(10): 1473. DOI:10.3390/ph16101473
    3. Board E. Editorial commentary on the special issue of cardiovascular diseases. J Biomed Res, 2023, 37(4): 229. DOI:10.7555/JBR.37.20230800

    Other cited types(0)

Catalog

    Figures(3)

    Get Citation
    PDF
    XML

    Article Metrics

    Article views (1151) PDF downloads (179) Cited by(3)
    Related

    ©2023 by the Editorial Department of the Journals of Nanjing Medical University. All rights reserved.   苏ICP备05071376号-5

    Supported by: Beijing Renhe Information Technology Co., Ltd. E-mail: info@rhhz.net  Baidu Analytics

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return